![[personal profile]](https://www.dreamwidth.org/img/silk/identity/user.png){kind=small}
I'm having GATTACA trouble again.
Feb. 28th, 2019 08:38 pmThere's nothing quite like searching files for things like TGATCGCGATGTCGTGGTAG.
And it's not immediately obvious when you're looking at two different documents that CTCGACTTCTTCGTCGCCTT and CTCACGCTCGACTTCTTCGT aren't the same, especially when the other primer is identical. I'm not even remotely dyslexic but I still get confused between CTCGAC and CTCACG, because my eyes blur after the first few bases.
(It's actually easier for that one if you start at the far end, or the 3' end if you know about DNA, since it's much easier to see that TT isn't GT than to have to skip the identical CTC bit.)
Where is my "bashes head against wall" emoji?
And it's not immediately obvious when you're looking at two different documents that CTCGACTTCTTCGTCGCCTT and CTCACGCTCGACTTCTTCGT aren't the same, especially when the other primer is identical. I'm not even remotely dyslexic but I still get confused between CTCGAC and CTCACG, because my eyes blur after the first few bases.
(It's actually easier for that one if you start at the far end, or the 3' end if you know about DNA, since it's much easier to see that TT isn't GT than to have to skip the identical CTC bit.)
Where is my "bashes head against wall" emoji?
