baratron: (goggles)
[personal profile] baratron
There's nothing quite like searching files for things like TGATCGCGATGTCGTGGTAG.

And it's not immediately obvious when you're looking at two different documents that CTCGACTTCTTCGTCGCCTT and CTCACGCTCGACTTCTTCGT aren't the same, especially when the other primer is identical. I'm not even remotely dyslexic but I still get confused between CTCGAC and CTCACG, because my eyes blur after the first few bases.

(It's actually easier for that one if you start at the far end, or the 3' end if you know about DNA, since it's much easier to see that TT isn't GT than to have to skip the identical CTC bit.)

Where is my "bashes head against wall" emoji?

Date: 2019-03-01 01:41 am (UTC)
brooksmoses: (Default)
From: [personal profile] brooksmoses
Wow. That's ... yeah. Even once I've looked at those long enough to know what's different and what isn't, so I know exactly where the differences are that I'm looking at, my eyes still blur a bit trying to see them.

There's probably a field-revolutionizing way to encode these in a manner that would actually allow human visual pattern-recognition gray matter to easily see the difference (and, ideally, see that the two long ones have a common substring but one has stuff in front of it and the other has stuff at the end) -- but I don't really know what it would be.

I am reminded, though, of a bit of data-visualization research I saw once that was encoding information into the parameters of line-art faces, so that any small information change would give you a slightly different cartoon face, because most humans are really good at subtle facial distinctions.

Date: 2019-03-01 06:15 pm (UTC)
thekumquat: (Default)
From: [personal profile] thekumquat
I remember using 'find' in text files rather a lot... Still better than smudged sets of 4 lanes on an autorad of a gel and sliding up with a ruler, mind you. Good luck with it!

Profile

baratron: (Default)
baratron

March 2022

S M T W T F S
  12345
6789101112
1314151617 1819
20212223242526
2728293031  

Most Popular Tags

Style Credit

Expand Cut Tags

No cut tags
Page generated Feb. 28th, 2026 06:31 am
Powered by Dreamwidth Studios