baratron: (goggles)
I haven't written much lately because I don't have a lot of spare energy with which to say anything. I am spending 2-3 afternoons a week in the lab, which wipes me out for the rest of the week. My chronic fatigue is such that 4 hours in lab requires the rest of the evening and the entire next day to rest. I don't even have to stand or walk much - I'm working in a tiny little microbiology lab smaller than the top floor of my house, where it is entirely normal to sit to do experiments because it's the only way to reach your arms into the laminar flow hood. But having to use my brain and my hands for several hours at a time is enough effort that I'm pretty much useless afterwards.

So I have been working, and making a ton of mistakes, and having to redo just about every experiment twice. Pretty sure this is entirely normal though, since they have been mistakes of inexperience. Like the other day I ran the PCR machine and didn't screw down the blue dial on the top to make the lid extra tight, so some of my samples evaporated. They're the kind of mistakes that a person who learns the way I do needs to make once in order to not make again. But it means that my progress is immensely slow. It really feels like two steps forward and one step back.

Other than that, I'm working for UESP. You can watch me on video most Monday nights from 9-11pm EDT (Tuesday 1-3am GMT) on the UESPodcast. (Broadcast live on Twitch and later on the Unofficial Elder Scrolls Pages YouTube. It's also available audio-only on various podcast services.) Although it's a voluntary thing and I don't get paid (except for the occasional free meal), I realised that I'm picking up a ton of Transferrable Skills which will be useful on my CV when I eventually try to get a Real Job.

Grant arrives on Monday 10th June for two weeks, and then I will have Both my Men in my house.
baratron: (goggles)
There's nothing quite like searching files for things like TGATCGCGATGTCGTGGTAG.

And it's not immediately obvious when you're looking at two different documents that CTCGACTTCTTCGTCGCCTT and CTCACGCTCGACTTCTTCGT aren't the same, especially when the other primer is identical. I'm not even remotely dyslexic but I still get confused between CTCGAC and CTCACG, because my eyes blur after the first few bases.

(It's actually easier for that one if you start at the far end, or the 3' end if you know about DNA, since it's much easier to see that TT isn't GT than to have to skip the identical CTC bit.)

Where is my "bashes head against wall" emoji?

Fried

Feb. 15th, 2019 06:05 am
baratron: (goggles)
My brain is fried. My body is fried too.

The anxiety and depression seem to be better but I have EPIC levels of chronic fatigue instead. I slept from 7.30am until 3.30pm on Wednesday, then from 8pm until 1am on Thursday, then from 7am until 2pm on Thursday, then from 5pm until 11.15pm. All times approximate.

I am attempting to do work for my degree after not having been well enough for some time, and I'm doing a very good impression of this meme right now:

I have no idea what I'm doing

Next week I have to make do without a Richard because he is being sent to Munich for work. I have no idea how that's going to work, either. (Volunteers who can come to Kingston to feed me will be welcomed if I'm not asleep. The being asleep at awkward hours is going to make that really tricky.)
baratron: (sleepy)
Hi! I realised yesterday that I haven't actually read Dreamwidth since before BiCon, which is a bit rubbish. I tried to catch up via my "Reading" page and it only went back as far as 26th August. So do please let me know of any events or changes in your life which I should know about. Also, tell me about BiCon which I was sorry to miss.

I am back at university, for some value of "back" which involves my working entirely from home on data analysis and going in to meet my PhD supervisor and Disability Mentor once a week. I had to write a chapter of my thesis and get that submitted to the Thesis Committee, and then have an exam on it (that was last Thursday). And then the day after I had to go and prove to the government that I'm still disabled (PIP Assessment).

So it's not really surprising that my chronic fatigue has been awful for three days. I have required 12+ hours of sleep, and woken up feeling like I haven't slept at all. Yesterday I was so exhausted that I couldn't really hold my own head up without support, which I have to say is a very unpleasant feeling.

Today I woke up with a worryingly large amount of energy. I got breakfast, found we were LITERALLY out of spoons, filled the dishwasher, cleaned the toilet, and that was it - 40 minutes later I'm sitting here feeling wobbly and ready for bed again. And that was even knowing that I needed to go carefully and conserve my energy, which was why I wasn't bounding up and down the stairs with laundry. Stupid illness.
baratron: (endurance)
Last night I spent about 3 hours filling in my Disabled Students' Allowance forms and wanted to die. There is nothing quite like detailing EVERY WAY in which you are medically broken to make you feel like a non-person.

I had to fill in three years' worth of forms in one go, because I need some funding for 2015/16 to cover 4 x sessions I had with my disability support mentor before deciding to go on a break in studies, as well as the current year (2016/17) and next year (2017/18), which made the whole experience extra tedious. Although virtually all the questions were the same, so I could copy and paste stuff.

The worst thing was that my name - "Helen-Louise" was too long to fit in the boxes of the older forms because apparently a first name should only have 10 characters in it?! I mean, what?

In other news I am slowly continuing to move people over from their old livejournal usernames to their new Dreamwidth usernames for access and subscription purposes. If you think you should be on my access list and are not currently (can you see this post?) feel free to leave me a comment here.

Plans

May. 5th, 2016 03:39 pm
baratron: (dino)
I did not get around to booking for BiCon. The closing date for accommodation was just too early considering that I have no idea what my health will be doing in July. If I am not much better than I am now, I will be going splat and having to go to bed in the middle of the afternoon, at unpredictable times, and it seems fairly pointless to pay money to go away in that scenario.

Which means you might be questioning how come I can go to Boston next week, but that will be easier since I will have the husband and the boyfriend, both of whom are entirely competent carers for me. If we're out and about and I feel too wobbly to carry on, I can trust either or both of them to get me back to the place where we're staying and/or get food into me. Neither of them want to go to BiCon (they are both way too introverted), and I don't have anyone else who is familiar enough with my current limitations to act as a carer. (I know people who would be happy to ensure I got fed, but I wouldn't want to ask any of them to give up what they want to do at BiCon unless I was paying them, which is a whole other kettle of fish and... yeah.)

I still need to talk to my university, because I was supposed to be going back when term started on 18th April, and I am clearly nowhere near well enough to go back for at least a few more weeks. It's likely that I'll actually go back next term instead, as long as they aren't going to give me grief about the fact you're only "supposed" to have a maximum of 2 years (6 terms) "off" on breaks of study during a PhD course. I'd love to be back, but it would be a waste of everyone's time and my money, since I just about have enough energy to get downstairs on average once a day. The increased thyroxine and vitamin D are helping up to a point, but I am not magically better and dancing around full of the joys of spring.

Today is however a glorious day and I went out to vote for the Mayor of London and London Assembly. No prizes for guessing which party won my first choice, and even my second choice is pretty easy to guess. (Hint: I didn't vote for anyone in favour of leaving the European Union). Politics lately are stressing me out: the London Assembly election today, the referendum on leaving the EU in a few weeks, and the horrible, hateful candidate up for election as President of the USA. Honestly, if it weren't for that nice Mr Trudeau, I'd be hiding under a rock.

Also today I washed my dinosaur. Yay! for clean dinos.
baratron: (endurance)
Yesterday and today, I've been wanting to talk to people but I have absolutely no spare energy with which to do so. I have reverted to taking 2000 iu of vitamin D per day as of today, because I'm shattered and not convinced that the 400 iu tablets are doing enough.

I'm supposed to be going back to College in 10 days or so, but I haven't sorted out any of the paperwork yet because it involves too much effort, and circular situations where I need a form from A to give to B and a form from B to give to C, but I can't get the form from A until I have the form from C. Gah! And right now, I am sufficiently exhausted that I am not even sure if I'm up to going back for this term. I really can't go back and then immediately have to take time off again, but I do need to get things like Disabled Students' Allowance in place again if I am going back.

Mental health has not been good in my little family this past week. We have all been depressed for no particular reason. Richard has been anxious, Grant has been tearful, I have been having nightmares. I know that I need to have my next trip to see Grant arranged as soon as possible, so it's settled and I have something to look forward to, but I just don't know when will be convenient. Since this year is a round-number birthday, I was hoping to do something special for it, but I am increasingly feeling that my original plan (go to Iceland again) isn't what I want to be doing this year.

While organising trips to various places, I have to decide if I am going to BiCon this year. I feel that it would be beneficial to me to be in bi space considering that I currently appear to the outside world as straight twice over, but it involves energy and organisation which I don't quite have right now. The deadline is apparently pretty soon though. Who else is going?

In other news, I have found some mysterious photos on my computer. I mean, they are patently photos of me and Richard hanging around in our hallway in January 2012, but it is mysterious as to why we took them. They are all exceedingly yellow and would require considerable correction in Photoshop to fix. I thought maybe Richard had bought a new camera and we were testing it out, but the numbering starts at IMG_6562.jpg. Weird!
baratron: (endurance)
So... I have received a hospital appointment letter for a course of physiotherapy, the first session of which clashes with the Graduate Symposium where I am supposed to be presenting a poster.

It is 4 consecutive weeks and you have to go to all 4. It runs from Thursday 18th June until Thursday 9th July, meaning that if I call back and say "I can't go", the next session is unlikely to be until Thursday 16th July. And that's if the physiotherapist isn't on holiday.

It wouldn't be so bad if it was in the morning, but it's 3.15-4.15pm. Ordinarily, this would be great - I'm always complaining about appointments from the Pain Clinic in the morning considering how brain-dead most people with chronic pain are at stupid o'clock. However, while I don't have the timetable for the Graduate Symposium yet, every year I've been aware of, the poster session has been on Thursday afternoon.

The timetable has not yet been printed or distributed. I pretty much have to be at the poster presentation (rather than just sticking my poster up and running away) since answering questions about one's poster is part of the assessment process. Even though I am never going to win any prizes because I'm a chemist in a biology department, and the likelihood is that I won't even be able to answer half the questions I get asked!

I have, for now, emailed my supervisor.

I assume the next step is emailing the conference organiser to check when the poster session will actually be, and calling the hospital to find out if they have any other times sooner than 16th July.

What other bright ideas can you think of? Sympathy also welcomed.
baratron: (bunches)
Viva went swimmingly. The examiners had already decided that my upgrade report was good enough to pass, so it was an hour and a half of how to improve it before the final thesis and thoughts about what the rest of my PhD research should look like. Nice and relaxed.

Now I need to sleep because I utterly failed to do so last night, despite many hours lying in bed.
baratron: (goggles)
So, tomorrow I have the viva (oral examination) for my upgrade report, which I am looking forward to about as much as anyone with anxiety would.

"Normal people" come out with comments like "Everyone gets anxious about exams". And I'm not saying that they're wrong. However a person without the actual psychological condition called anxiety is highly unlikely to get into a state where they can't function because they've lost one specific notebook, and it's 5 am, and they've been looking for an hour, and their partner is urging them to give up and work on something else in the meantime. And - get this - they even have all of the information contained in that notebook in other notebooks which aren't lost.

But they can't stop looking because there's a misfiring neuron in their brain which won't let them concentrate on anything else except the fact that the notebook is lost and so they don't have the material to look over and so they're going to fail the exam.

Yeah. That's just not a thing which happens to people who don't have anxiety. Parts of it, maybe. But the whole irrational chain of catastrophe? No.

It actually turned out not to be the end of the world at all because in rewriting the notes, I realised something that I hadn't worked out before, and now if they ask about it tomorrow I'll be prepared. But I could have done without that sort of episode of stress.

I feel fairly prepared now, but I don't like the idea of the time I need to get up in the morning. The exam is at 1.30pm, so I need to be on the 11.48 am train to make sure I have loads of time in case of, I dunno, snow. I REALLY don't think it's going to snow but my mother insists it's on the forecast, so getting up super-early in case the trains are more screwed up than usual it is. Urgh. My hair feels absolutely horrible but I do not have the spoons to wash it. It's do the exam with dirty hair or have clean hair and be too tired to function. Really, they are not examining me on my hair.

In related news, it turns out that the reason why my Department hasn't been following my Individual Student Support Agreement (ISSA) for the past year-and-a-bit was because they didn't have it. Somebody screwed up. I even know who the somebody was, but it's pointless yelling about it now. However, that was a big load of stress on Tuesday which I didn't need! The College is now using something else instead of an ISSA so I have to make an appointment with the Disability Office to get that sorted out, but not before tomorrow.
baratron: (pokemon scientist)
My theme for the day is Being a Responsible Adult. Look at me deciding to not buy Pokemon Alpha Sapphire until after my Big Deadline at university! Look at me booking a doctor's appointment at the contraceptive clinic to get my coil checked! Look at me sitting down to do homework for tomorrow's class, even though I'm not taking it for credit!

Now, if only Being a Responsible Adult stopped me being so damned tired, I'd be delighted.
baratron: (corrosive)
Oh dear. I have made Richard unhappy. I didn't quite realise that he was talking about going back to Canada THIS TUESDAY i.e. 28th January i.e.in a week. I was focused too hard on the being in Toronto around the middle of February part and not really thinking about the beginning of the trip.

I know nothing about Montreal other than that they speak weird Quebec French, the Biodome is really good, and anything I have picked up from the Kathy Reichs books which are set there. I shall have to search [livejournal.com profile] papersky and [livejournal.com profile] redbird's past lj entries about things to do in Montreal. And I need to find out how accessible the city is, especially in winter weather conditions.

I am now very stressed because I need to get enough meds and clothes for the trip, as well as sorting out enough work to take with me. I'm planning to work for half the time and look at museums, zoos etc for the rest of the time. (Probably one day of work followed by a day of sightseeing). A week doesn't seem like long enough to sort everything out. Argh!
baratron: (Buttercup)
I am having a horrible, no good, shitty day.

Woke up after 8 hours of sleep, but was still so tired that I almost put my phone & train ticket in the bin instead of my used paper cup.

Went to College. Dealt with a series of idiots. You see, I discovered at the end of last term that my Library account expired on 30th November. The Library's records claimed I was a "dormant student, not in contact with the College", which is interesting considering that I have completed Enrollment and paid fees!

It is sorted now, but only *after* some twat in Birkbeck admin managed to fuck things up worse than they already were. At one point, not only did the computer think I wasn't enrolled, but it also thought I owed money for the two terms last year when I was on a leave of absence! And it wanted me to produce £314 out of thin air!!

Stressed beyond belief. Funny, that. Was ready to kill someone, possibly myself. Not even joking. I don't know if it's "normal" to get so stressed by minor administrative cock-ups, but I have an anxiety disorder plus another disorder which makes my body produce too much adrenaline, and I just didn't bloody need some twonk trying to fix the problem and making everything worse! Nor accusing me of not enrolling on time! (How would the College have known where to take direct debits from if I hadn't enrolled?!)

Then I tried to go to Camden. Discovered the bus was on diversion because Upper Woburn Place is being dug up, but half the stops didn't have any explanation of the diverted route. Eventually found a 168 stop at bloody Holborn - so far south that I'd have been better off walking to Euston. The worst thing is, I even knew about this diversion. I'd just forgotten.
baratron: (pokemon scientist)
Tired. The past few weeks I have done very little other than teach myself spectroscopy from a book, play Oblivion, and deal with a large amount of internet forum wank. The spectroscopy is in preparation for the real spectra that I need to start interpreting as soon as possible. It's interesting, but only to people who already know about organic chemistry. For example, I got very excited yesterday to see a peak at 2220 cm-1 on an infra-red spectrum, because normally there's basically nothing between 2800 and 1800 cm-1, but you have to know that in order to be excited about it. Hrm.

I keep thinking that I should comment on people's posts, and especially keep thinking that I should write a few reviews of books I've written recently, but it's SAD season and I'm tired, and my PhD work has to take priority. I feel moderately positive about my work - every so often I have episodes of "I'm so stupid, why don't I know/remember this stuff?", but they last less than a minute because my brain's immediately countering it with "Because you haven't thought about it in 14 years", "Because techniques have improved and you never learnt this before."

Anyway. I thought I should post even though this isn't very interesting to people who aren't me, so you know I'm still alive. Also, I want livejournal to have more content on it. I swear that most of the sharing of interesting links has moved onto Twitter or Facebook, but I don't much like either of those. Ah well.
baratron: (rainbow chemistry geek)
Still trying not to beat myself up. The problem of the last two days has been stupid biochemistry textbooks.

Yesterday I was suffering from a disagreement between Wikipedia and the textbook I was using. The textbook claimed that the reaction which converts pyruvate into acetyl-coenzyme A was catalysed by pyruvate decarboxylase. Wikipedia said it was actually catalysed by pyruvate dehydrogenase, and that these are two separate enzymes which should not be mistaken for each other despite their similar names and functions. Normally, one would generally believe a sourced textbook over Wikipedia, but the wiki was so insistent that I thought it was worth double-checking.

I found the 2012 edition of my textbook on Google Books, and that section was identical. I did, however, find a much more comprehensive textbook on Google Books which had more than 750 pages, which made it clear that it's pyruvate decarboxylase for the reaction that makes ethanal and pyruvate dehydrogenase for the one that makes acetyl-CoA, or in other words, my textbook is wrong and Wikipedia is right. That wasted... I don't know, 20 minutes of my time?

Then I was having trouble with FAD/FADH2 and NAD+/NADH redox reactions. Even my enormous Organic Chemistry book OF DOOM doesn't bother to write the mechanisms! They're just classed as a black box of "in here a miracle happens". I'm aware that there are different theories for how they work (1 x 2 electron transfer rather than 2 x 1 electron transfer), but I just wanted to be able to write a mechanism because I'm a chemist and I like to know where electrons go. (It's the only way I can learn structures). I ended up with something that looked entirely plausible until I saw what I thought was a hydride ion attacking a benzene ring - totally impossible since it would be a negatively charged ion attacking a region of high negative charge. I then proceeded to freak out and try various rearrangements of molecules and curly arrows for 2 hours, until I bothered to consult the enormous Organic Chemistry book OF DOOM and discovered that pyridine and benzene reactivities are actually really different. Duh.

Now I have to not beat myself up for forgetting something "basic" in organic chemistry, pun not intended. I'm doing fairly well at reminding myself that if you don't use information for 18+ years it drops out of your head and that doesn't mean you're stupid, just that you need to revise - but cheerleading from friends might help with this.

Mostly, I'm pissed off with the biochemistry textbook I have. It was the least awful one available in the library (i.e. it actually shows every chemical structure rather than glossing over them whenever possible), but it has an innate assumption that you started at the beginning and are working through it sequentially to the end. That might be appropriate with a small tutorial text of, say, 150 pages - but it doesn't seem appropriate for a massive course textbook of over 500 pages! I like to be able to delve into a textbook, find what I need, and get back to my work, NOT be forced to flick through previous or subsequent chapters because "You will see later that...". I would be so annoyed if I'd bought this book, rather than simply borrowing it from the library.

[livejournal.com profile] stellarwind has been awesome in helping me make sense of random biochemistry. Every home should have one.

Also, my sleep patterns have been as bizarre as usual, but I've simply been doing work when I'm awake, sod what time the clock says it is. This works right now, but might be a problem when I have to start going into College more regularly.
baratron: (goggles)
I have officially started back on my PhD. Apparently I didn't manage to tell you that I was eventually successful in getting my project changed, probably because my head was all over the place at the time. I also have a laboratory assistant who is presumably going to be paid out of Disabled Students' Allowance money, and who has been working for a couple of weeks.

Today I did about 4 hours of work. Not what you might consider "proper PhD-level research", but work with textbooks and online sources and mechanisms nonetheless. Revising things I'm supposed to know and learning new things that I haven't been taught.

I need to stop getting myself down/beating myself up because of everything that I don't have energy/spoons/tuits to do, and start celebrating everything positive that I do manage.

I need to stop comparing myself to other PhD students and postdocs who either have no health problems at all, or have everything well under control. Most human beings do not need to rest and/or sleep for literally half the day every day. It's no wonder I can't work at the same rate as other people when I need so much downtime in order to function.

What I really need is some role-models with long-term chronic illnesses which wax and wane and sometimes require them to take several months of leave of absence, but who have managed to achieve to a high level nonetheless. Anyone know where to find such a thing? I often feel as though I am THE only scientist in the world with my kind of health problems. And don't mention Stephen Hawking, he's exceptional. I have neither his brain nor his energy level.

Argh.

Sep. 13th, 2013 03:14 am
baratron: (introspection)
Deeply and profoundly stressed. Dealing with stressors now. Have failed to enrol at uni because the College website is currently down. But I have filled in my Disabled Student's Allowance form, and found and photocopied all the new medical evidence for it. I have also dug out all my overdue library books and found some photos of myself to get a new library card. (I go to Birkbeck College but also get library books from University College London as well, and their library card expires at the end of each academic year. The books are overdue because I couldn't renew them).

I still need to claim back all the receipts from my DSA for this academic year, and photocopy all the evidence for a Freedom Pass, but I can't deal with any more stress tonight.

I have no idea when to attempt sleep. I slept from 5pm to 11pm or so, waking up because I had a headache from not taking my meds. That was after having been awake since, er, 9pm the night before? And I need to be awake by 1pm today. I'll, um... worry about it later.
baratron: (Luka)
Well, that was one of the more amusing/mortifying moments of my life. So I went to the free lunch with the visiting speaker today, & that was all well & good. I had a jacket potato with baked beans, but I could also have had soup or salad. Then I tried to go to the lecture. 40 minutes of wandering later, I got confirmation from UCL Room Bookings that no, that venue really isn't wheelchair accessible.

So it looks like I went to the lunch because it was free but couldn't actually be arsed to attend the lecture afterwards. I need to find the lecturer's email address & apologise.

Also, I went back to the Graduate Office in my department at Birkbeck (= rather small College of the University of London) to complain, & they were shocked that UCL (= large & prestigious College of the U o L) had rooms which weren't accessible! Dudes... Did you think to ask?

Though I found out that the Graduate Symposium isn't in Mill Hill at all, it's in UCL. This would be good, if not for the fact it's currently booked to be in the same venue that I couldn't get into today. Laugh? It's that or cry.
baratron: (science genius girl)
I'm feeling well enough to restart my PhD again this term. Spoke to Philip on Friday about changing my project to something more manageable with my physical limitations, and that actually went remarkably well. I'll write more about it when it's all been approved by the Graduate Committee.

There are various Things to deal with this term: the Graduate Symposium and the Retreat, both of which terrify me. I still don't know how exactly I'm going to get to Mill Hill for something that starts before 10 am, or how I'm going to manage for a whole day in a strange place without anywhere to go and collapse if necessary, but I'll work that out later. The Retreat is in Cambridge and involves an overnight stay, and is no doubt fully catered, which fills me with utter horror. I have a long-term phobia of Other People Controlling My Dietary Intake. It started when I was a teenage vegetarian and people thought I would eat chicken, or chilli with the pieces of meat fished out (eww). It's only got worse as I've developed quite genuine food intolerances. Traces of dairy make me really very unwell in the digestive department for an alarmingly long time.

Perhaps in preparation for this, I am doing something on Wednesday which terrifies me. They picked six random students and invited us to lunch with the visiting speaker at College. I'm not sure if it was random or if they looked for people whose work was vaguely relevant to hers. I wrote back and said that it isn't that I *can't* go, but that I have lots of food intolerances; but apparently there is no prebooked menu, and you can choose anything they sell. So I agreed to go because I've become way too good at avoiding things which make me anxious. At a time of mental health crisis, it's reasonable to avoid extra stress, but in the long term it isn't healthy - you can't get through life by avoidance.

I will no doubt regret this decision multiple times between now and Wednesday afternoon, but what is the actual worst that can happen? That there's nothing I can eat apart from a bit of salad and fruit? No one ever died from missing one meal! I have to keep my fears in perspective.
baratron: (boots)
I've been randomly unpleasantly ill for a couple of days. Woke up on both Tuesday and Wednesday with pins-and-needles in both arms and my hands curled up into claws. Then it took several hours for my hands to be usable, and they were still numb/pins-and-needle-y for the rest of the day. Ugh. This is a thing that happens to me occasionally, I still don't know what the trigger is (if it was RSI from too much Oblivion, wouldn't it have started while I was still playing the game rather than the next morning?), but it's annoying.

Today I woke up with more energy than I've had in weeks, and:
* emailed College about a break in studies for illness reasons.
* booked tickets to see Jettblack on Saturday 27th April.
* phoned the venue in Glasgow about the Wildhearts on Thursday 4th April to check that the disabled access was sorted. (Apparently it is, they just didn't tell me about it).
* scanned in a lease for my mother, which was a task and a half because the scanner did things like forgetting to crop the images to A4 size (my fault for not choosing the right settings), and forgetting how to save as a PDF (definitely a software failure, since it saved fine as .png).
* talked to my mobile phone company about getting a cheaper contract (apparently possible at the end of this month when I'm eligible for an upgrade).
* put some laundry on.

I still have to write a letter for my doctor to get the supporting evidence for the break in studies, FINALLY sort out the paperwork for the Freedom Pass, wash my hair, and do some writing. I'm not sure that the writing will happen. I'm only half-sure that the hair-washing will happen, but it's reached the point of being absolutely foul and pestilent, and ready to walk off my head. I haven't done the Wednesday book meme, but then I haven't actually read any books this week, only newspapers and fanfic.

Also, tomorrow I need to phone East Coast about the fact they seem to have booked assisted travel three times for the outward journey to Glasgow and not at all for the return. I really would like to add up how much of my precious time and energy is spent on disability things - not activism, just basic access. I fear it's rather a lot.

Profile

baratron: (Default)
baratron

March 2022

S M T W T F S
  12345
6789101112
1314151617 1819
20212223242526
2728293031  

Syndicate

RSS Atom

Most Popular Tags

Style Credit

Expand Cut Tags

No cut tags
Page generated May. 9th, 2026 08:09 am
Powered by Dreamwidth Studios