baratron: (goggles)
There's nothing quite like searching files for things like TGATCGCGATGTCGTGGTAG.

And it's not immediately obvious when you're looking at two different documents that CTCGACTTCTTCGTCGCCTT and CTCACGCTCGACTTCTTCGT aren't the same, especially when the other primer is identical. I'm not even remotely dyslexic but I still get confused between CTCGAC and CTCACG, because my eyes blur after the first few bases.

(It's actually easier for that one if you start at the far end, or the 3' end if you know about DNA, since it's much easier to see that TT isn't GT than to have to skip the identical CTC bit.)

Where is my "bashes head against wall" emoji?
baratron: (test tube)
My Graduate Symposium went well. Turned out that the poster presentation was on Friday, so I could go to my hospital appointment after all.

I got there on Friday lunchtime, concerned because we were supposed to have put up the posters "at the start of the conference". Actually, when I got there, 9 out of the 32 posters were up. There were no fixed places, you could choose where to put your poster, and I put mine on a poster board that was a little out of the way, but had enough space for me to sit in my wheelchair in front of it. This turned out to be very helpful since the basement room was ridiculously hot and noisy by 2.30pm and I would have felt horribly claustrophobic anywhere else.

Not many people bothered to come over to see my poster (the pitfalls of being a chemist in a biology department) but I managed to impress everyone I spoke to.. And my thesis committee chair was very excited by the potentially NEW STUFF that I might have discovered and said I must get the work finished and written up for publication as soon as possible :)

I didn't win a prize but I didn't expect to - one prize for 32 students & it's not going to be given to one of the two chemists in a room full of biologists. Frankly, the prize was having my thesis committee chair so pleased with me and my work. I don't need a £30 book token for that.

I actually wrote a nice email to the woman who organised the conference thanking her for everything she'd done to make it accessible, with specific examples so that anyone else who does the job can see the sort of thing that is helpful.
baratron: (bunches)
Viva went swimmingly. The examiners had already decided that my upgrade report was good enough to pass, so it was an hour and a half of how to improve it before the final thesis and thoughts about what the rest of my PhD research should look like. Nice and relaxed.

Now I need to sleep because I utterly failed to do so last night, despite many hours lying in bed.
baratron: (goggles)
So, tomorrow I have the viva (oral examination) for my upgrade report, which I am looking forward to about as much as anyone with anxiety would.

"Normal people" come out with comments like "Everyone gets anxious about exams". And I'm not saying that they're wrong. However a person without the actual psychological condition called anxiety is highly unlikely to get into a state where they can't function because they've lost one specific notebook, and it's 5 am, and they've been looking for an hour, and their partner is urging them to give up and work on something else in the meantime. And - get this - they even have all of the information contained in that notebook in other notebooks which aren't lost.

But they can't stop looking because there's a misfiring neuron in their brain which won't let them concentrate on anything else except the fact that the notebook is lost and so they don't have the material to look over and so they're going to fail the exam.

Yeah. That's just not a thing which happens to people who don't have anxiety. Parts of it, maybe. But the whole irrational chain of catastrophe? No.

It actually turned out not to be the end of the world at all because in rewriting the notes, I realised something that I hadn't worked out before, and now if they ask about it tomorrow I'll be prepared. But I could have done without that sort of episode of stress.

I feel fairly prepared now, but I don't like the idea of the time I need to get up in the morning. The exam is at 1.30pm, so I need to be on the 11.48 am train to make sure I have loads of time in case of, I dunno, snow. I REALLY don't think it's going to snow but my mother insists it's on the forecast, so getting up super-early in case the trains are more screwed up than usual it is. Urgh. My hair feels absolutely horrible but I do not have the spoons to wash it. It's do the exam with dirty hair or have clean hair and be too tired to function. Really, they are not examining me on my hair.

In related news, it turns out that the reason why my Department hasn't been following my Individual Student Support Agreement (ISSA) for the past year-and-a-bit was because they didn't have it. Somebody screwed up. I even know who the somebody was, but it's pointless yelling about it now. However, that was a big load of stress on Tuesday which I didn't need! The College is now using something else instead of an ISSA so I have to make an appointment with the Disability Office to get that sorted out, but not before tomorrow.
baratron: (science genius girl)
Woo. I feel clever. I worked out that a certain molecule had to be put together in cells by polyketide synthesis. And the mechanism I sketched the other day appears to be basically correct, except I didn't know about a particular gene carrying out selective reductions.

I am recording this since research involves many episodes of feeling like you are the most stupid person on the planet and no one could possibly be as awful as you, and it's nice to celebrate those occasional moments when you get to feel pleased with yourself :)

In other and mostly unrelated news, I am Annoyed with the Pain Management Clinic at Kingston Hospital for failing to get back to me regarding the results of the MRI I had on 5th August. I have been chasing them up since last Friday. The receptionist suggested that the pain management doctor might call me at the end of his clinic on Monday, but he hasn't and - to be honest - nor did I expect him to. I just want to know what's supposed to be happening next, you know? Do I continue taking more and more gabapentin? Is there something obviously physically wrong that they might be able to treat?
baratron: (rainbow chemistry geek)
Still trying not to beat myself up. The problem of the last two days has been stupid biochemistry textbooks.

Yesterday I was suffering from a disagreement between Wikipedia and the textbook I was using. The textbook claimed that the reaction which converts pyruvate into acetyl-coenzyme A was catalysed by pyruvate decarboxylase. Wikipedia said it was actually catalysed by pyruvate dehydrogenase, and that these are two separate enzymes which should not be mistaken for each other despite their similar names and functions. Normally, one would generally believe a sourced textbook over Wikipedia, but the wiki was so insistent that I thought it was worth double-checking.

I found the 2012 edition of my textbook on Google Books, and that section was identical. I did, however, find a much more comprehensive textbook on Google Books which had more than 750 pages, which made it clear that it's pyruvate decarboxylase for the reaction that makes ethanal and pyruvate dehydrogenase for the one that makes acetyl-CoA, or in other words, my textbook is wrong and Wikipedia is right. That wasted... I don't know, 20 minutes of my time?

Then I was having trouble with FAD/FADH2 and NAD+/NADH redox reactions. Even my enormous Organic Chemistry book OF DOOM doesn't bother to write the mechanisms! They're just classed as a black box of "in here a miracle happens". I'm aware that there are different theories for how they work (1 x 2 electron transfer rather than 2 x 1 electron transfer), but I just wanted to be able to write a mechanism because I'm a chemist and I like to know where electrons go. (It's the only way I can learn structures). I ended up with something that looked entirely plausible until I saw what I thought was a hydride ion attacking a benzene ring - totally impossible since it would be a negatively charged ion attacking a region of high negative charge. I then proceeded to freak out and try various rearrangements of molecules and curly arrows for 2 hours, until I bothered to consult the enormous Organic Chemistry book OF DOOM and discovered that pyridine and benzene reactivities are actually really different. Duh.

Now I have to not beat myself up for forgetting something "basic" in organic chemistry, pun not intended. I'm doing fairly well at reminding myself that if you don't use information for 18+ years it drops out of your head and that doesn't mean you're stupid, just that you need to revise - but cheerleading from friends might help with this.

Mostly, I'm pissed off with the biochemistry textbook I have. It was the least awful one available in the library (i.e. it actually shows every chemical structure rather than glossing over them whenever possible), but it has an innate assumption that you started at the beginning and are working through it sequentially to the end. That might be appropriate with a small tutorial text of, say, 150 pages - but it doesn't seem appropriate for a massive course textbook of over 500 pages! I like to be able to delve into a textbook, find what I need, and get back to my work, NOT be forced to flick through previous or subsequent chapters because "You will see later that...". I would be so annoyed if I'd bought this book, rather than simply borrowing it from the library.

[livejournal.com profile] stellarwind has been awesome in helping me make sense of random biochemistry. Every home should have one.

Also, my sleep patterns have been as bizarre as usual, but I've simply been doing work when I'm awake, sod what time the clock says it is. This works right now, but might be a problem when I have to start going into College more regularly.
baratron: (test tube)
I have been quite spectacularly busy the past few days. Have been to the Paralympics twice, about which I will write more later. (Though I shall note that Richard & I were at the Athletics event described in section "You can come second and set a new world record", and had to puzzle out how that was possible.)

Today I was supposed to be at College setting up my first organic synthesis in something like 16 years, but my body decided to give out on me entirely and I spent the day asleep. I will be making a chalcone on Friday instead, and am getting progressively more anxious. Since it does not go back as far as 1996, my livejournal does not relate the story of Evil Pink Stuff, which was the last organic synthesis I ever did. It was supposed to be o-benzoylbenzoic acid. Absolutely none of the starting, intermediate, or final compounds are pink. Neither was the catalyst I put in & am pretty sure removed correctly. Yet pink was what I obtained. Pink, gelatinous precipitate, instead of a fine white powder. Gods only know what it was. I'm not sure I had enough time to do all the tests to find out. And I'm traumatised enough by other happenings that year not to want to poke into the box of Here Be Dragons that contains, among other things, my second year lab reports - though definitely curious enough to consider it.

Another point: my phone is being strangely evil of late. I used to frequently comment on livejournal (and deadjournal) from it, but for some reason when I type now, I keep hitting the full stop key by mistake. So I end up with Sentences. That. Look. Like. This., which look terrible and require lots of painful correction (since I don't get on with touchscreens), unless I take the artificial and non-ergonomic step of only hitting the space bar with my left thumb. This slows down my typing, and is actively uncomfortable, and as a result I'm not commenting on anything anywhere near as much as I used to. I've got to figure out if it's me or my keyboard at fault. (Hand positioning, or sticky keys? Or some sort of software "upgrade" that's making the keyboard more sensitive?). Anyway, it means I'm not replying to things when I want to, since I mostly do "social" internet from my phone. But I still love you & care about things in your lives.
baratron: (wolfy)
Those of you who were watching my journal last week would be forgiven for worrying that I had been horribly maimed or murdered by my research report, since I never got back to livejournal to tell you that I'd survived. Actually, no death or serious injury occurred, except to my stack of spoons, which went so badly into overdraft that it took almost a week of sitting on my arse on the sofa playing Oblivion before I could think about work again. (Yes, I'm going backwards - having spent something like 300 hours on Skyrim, and nowhere near finishing it, I decided to try Oblivion, the previous Elder Scrolls game. Which turned out to be a good thing, since it's much less immersive than Skyrim (the UI in particular sucks on Xbox 360), you can't ever forget you're playing a game, and it's easier to STOP playing and get on with something else).

I am now basically fine, apart from being extra-prone to nightmares. They've been ranging from so realistic that I wake up having an anxiety attack and am useless all day, to so over-the-top that they're obviously "just dreams". Like the one I had last night about BiCon, which featured such delights as the days in the programme book being in the wrong order, so the workshop I was running which I thought was at 12pm on Friday was actually at 12pm on Thursday, and us using many tiny classrooms in a huge university block, around others which were still being used for classes. (None of which would ever happen in real life). And someone giving a talk about protein science, which I went along to out of interest, discovered that a lot of it was wrong and wondered if I was supposed to pull the "I'm a PhD student in this discipline and you're talking bollocks" tag. (Why would someone give a talk about protein science at BiCon anyway?). If the tenses in this paragraph are bizarre, you can blame the fact I'm talking about a dream.

What else? We finally went to Whipsnade, and Saw The Bears. Photos exist, but are unlikely to be online unless I can persuade Richard (the perfectionist) to spend an evening sorting them out and posting them. The sloth bears (Melursus ursinus) were small and cute and not hugely interesting. The brown bears (Ursus arctos arctos) were awesome and snuffly! We spent ages watching them since when we got there, they were mostly sleeping. Or at least, dozing - all bears have multiple stages of activity and rest during the day. So we had to wait for them to wake up.

Bear number 1 spent the whole time lying down, so she was quite beautiful but not very interesting. Bear number 2 spent most of the time doing bear yoga - sitting on her big bear bottom stretching out one back leg, then stretching out her front leg on the same side to touch it. Then she got up and started foraging for carrots and apples which the keepers toss into the grounds. Bear number 3 was way back in the forested part of the enclosure so we couldn't see what she was doing - but then she came forward and foraged too.

We also saw Very Squeaky otters, parts of red pandas (the rest hidden by foliage), a herd of wild boars, a wolverine, many penguins, Moosen In The Woodsen, and wolves. Which were very far away, and mostly doing impressions of wolfskin rugs. Also some obscure relative of donkeys, the name of which I've forgotten, unicorn rhinos, and giraffes. We did not see elephants because I was running out of wheelchair battery.

Unrelated to the above, I saw Rock of Ages at the cinema. It was immensely silly. I loved it, but then I am also the person who saw Blades of Glory on an aeroplane and went out & bought the DVD. If you love naff 80s hair metal/cock rock, watch Rock of Ages. If you hate it, don't bother.

Now I need to find someone to go to the musical with, since Richard hates all musicals.
baratron: (Buttercup)
I don't even know how many hours I've spent in the past day trying to figure out how many data files I have. You'd have thought it'd be easy. Count up the number of filled lines in the spreadsheet. Easy.

Well, it would be easy if it wasn't for the fact that I'm getting 114 from one dataset, 113 from the second, and 114 from the third! I really need to know how many files I processed since the percentages depend on it, but it won't add up.

Program L: has 114 Human files, consisting of 107 filled Inhibitors + 7 adenosine nucleosides.
Program P: has 113114 Human files, consisting of 96 filled inhibitors + 7 adenosine nucleosides + 10 files that are waiting for data (program currently crashes when i run it with those ligands), +1 little bastard file that ran okay, but didn't get added to the main database for reasons unknown.
Program V: has 114 Human files, consisting of 98 filled Inhibitors + 7 adenosine nucleosides + 9 files that are waiting for data.
WHY.
WHY IS THIS NOT THE SAME NUMBER???
baratron: (shiny)
Yesterday, when I went to bed, it was grey and drizzling, and I thought "hooray, that's my birthday rain". I've had less than 10 dry birthdays in 36 years. There's an actual reason for it, too, but I can't share it with you because it's from an old copy of The Times and they now want a login for it - even though it's from before they started charging for online content! You'll have to make do with my summary from the time.

Today I have received the best birthday present ever, which is a drawing from [livejournal.com profile] stellarwind. Everything in the picture is a reference to something in my life, and I don't actually EXPECT anyone to get all of the references, unless they're me :) It's still pretty awesome to share, though. I need an emergency spoon dispenser in real life, and the "thirty-six impossible hydrogen bonds" is both a double pun AND based on an actual problem that I've been having with my work.

I don't expect to get any more birthday presents until I have time to use them, which is fine by me. Work is being awful, and doing that thing it does of expanding to more-than-fill the time available. I've spent three whole days trying to get a program to work with certain files, and if my supervisors can't come up with a magical solution today, I'm going to throw them out, because I can't afford to waste any more time on this part of the project. I'll just write about the files which did work.

I hate being under an impossible time pressure.
baratron: (test tube)
I am "okay". Magically started feeling better about a month ago, and have been working steadily on my PhD research ever since - but I am still buried up to my eyebrows in work and sinking.

I have a deadline of 6th July for my next report due in to the Graduate Committee, with ideally about 3 months of work to do between now and then. It's okay - I've discussed the situation with my supervisors and we've worked out what I need to do rather than what it would be nice to do, and got that 3 months down to what's possible in a few weeks, but nonetheless I am busy and barely coping.

Also, to make things worse, we have tickets to see Adrenaline Mob on 5th July, meaning that I actually need to get the report almost-completely-finished a day early. I am not missing that gig! It was bad enough missing Steel Panther, Mötley Crüe & Def Leppard in December, but they're all bands that I only "vaguely" like, playing in a big arena. I'm not missing the mighty Mike Portnoy playing METAL in a tiny venue!

So I am being a "crap friend". People are posting about difficult things in their lives, and I've been reading livejournal but hardly commenting on anything - even when the other person desperately needs comments! It's not that I don't care, it's that coherence is not happening awfully well. I need to find out again who is happy to receive blank comments (meaning "I have read this and am sorry that things are difficult for you right now, but I have no spoons for coherent thought"). Either that, or I need to get the copy-and-paste on my phone working better so I can paste that sentence in every time.

In other news, my birthday is mostly cancelled this year - due to the fact that I'll have to spend it working. I'm planning to be at BiFest on Saturday briefly, probably from 2.30-5pm. Let me know if you're going. Also we've been planning to go to Whipsnade Zoo for months (we need to see the bears. Bears are good for stress relief), and finally settled on Sunday June 24th. Let me know if you feel like coming along, especially if you have a car. It's possible to get there by public transport, but not desirable. The bus from the nearest station is only every 2 hours on a Sunday, and is timed so that you miss it.

Anyway, I'm sorta falling asleep now, so I'll post this and go to bed. G'night :)
baratron: (science genius girl)
I am actually really happy with the way my PhD project is going right now.

I am recording this feeling since it doesn't come around all that often ;)

Seriously - I spend a lot of time wondering if I'm doing the right thing, if it's going anywhere, feeling lost and/or unsupported by my department, and/or trying to catch up with work I've missed through being ill. This is in addition to all the usual stresses on PhD students.

Right now, I feel as though I have a range of both short- and long-term goals, and I have some idea where I'm going. I trust Mark W, my new second supervisor, to be familiar with the current computational chemistry literature & am fairly confident that no one else has done what I'm trying to do. Several things I'm doing could independently make short journal articles if they work out.

It's kinda nice to have some self-confidence occasionally.
baratron: (rainbow chemistry geek)
Today I am trying to work out whether (deep breath):
(4E,6Z,8S,9S,10E,12S,13R,14S,16R)-13-hydroxy-8,14,19-trimethoxy-4,10,12,16-tetramethyl-3,20,22-trioxo-2-azabicyclo[16.3.1]docosa-1(21),4,6,10,18-pentaen-9-yl carbamate
is the same thing as:
(4Z,6Z,8R,9R,10Z,12R,13R,14R,16S)-13-hydroxy-8,14,19-trimethoxy-4,10,12,16-tetramethyl-3,20,22-trioxo-2-azabicyclo[16.3.1]docosa-1(21),4,6,10,18-pentaen-9-yl carbamate.

It would be easy if all the stereochemistry was inverted, but it isn't - one double bond is the same and one side-chain is the same in both naming schemes.

Anyone who says that I'm a chemist so I should be able to work this out will be shot, since most people's brains freeze up when confronted with a molecule name on three lines. It takes some sort of special IUPAC knowledge to be able to cope with ridiculously complex molecules. Everyone else calls this thing geldanamycin.

The real question is whether I can invert the stereochemistry at every single one of those stereocentres, or if the groups always have to stay in the same configuration relative to each other. I have no clue.

I predict that my evening is going to involve making this monster out of my molecular modelling kit, since I simply can't deal with complicated shape stuff on paper.
baratron: (goggles)
I'm trying to make sense of the synthesis route that I'll need to follow once I get into the lab. The two problems I'm having with it are (a) that it is written in a highly condensed "scientific" style whereby all the conditions, masses and concentrations are crammed into the paragraph in brackets and (b) that the person who wrote it is either dyslexic or a really bad typist (impossible to tell which). All I know is that "Cream percipitae was then fillitered off and washed with water affording Z16 as a cream percipitate." is not English.

I presume that what happened was that Microsoft Word put little wavy red lines under absolutely everything (since it will only recognise the simplest of chemical names), and so key words like "precipitate" and "filtered" slipped through with their "interesting" spellings. There even exists an Open Source chemistry spellchecker, but too many people don't know about it yet. I wish College would automatically install it on all machines that are likely to be used by chemists...

I am however pleased to note that the starting chemical for one of my syntheses is vanillin. I predict being RAVINGLY HUNGRY for the whole of that day ;)
baratron: (test tube)
Hello! I haven't written anything in livejournal for weeks. If you're wondering where I've been, the answer is mostly at home. If you're wondering why you haven't seen anything from me (and are wondering if I'm writing lots of secret things which are filtered away from you), the answer is that I genuinely have not posted anything since my public post of 22nd September. Why not? I've been busy with trying to sort out my body clock and get back into working...

I have a backlog of 5 or 6 posts to make when I find spoons for them (maybe this weekend?), but for now, I have a question for anyone who knows anything about postgraduate students and/or Macintosh computers.

I'm looking for lab notebook software that time-and-date-stamps everything you write. It's important to keep good records in case of disaster later, and it's important to have clear what you knew when. However, most of the programs labelled as "electronic lab notebooks" are designed for industry and are ridiculously expensive and feature-ful. Apparently, other postgraduate students have used Evernote, Google Notebook, Circus Ponies Notebook and wiki and blogging software - but I'm not sure how they're "getting away with it" since only wikis (to my knowledge) will datestamp everything. Even blogs are editable later, though I don't *think* you can fake the datestamp on the initial post.

Does anyone have any ideas that are easier to use than a wiki? Having to learn something akin to HTML simply to mark up my own lab notebook seems almost as much hassle as writing it out by hand, though there may be wiki editors like livejournal clients available now. (I still miss Semagic after switching from Windows to Mac - Xjournal is miles better than typing directly into the web interface, but awful compared to Semagic).

Feel free to point other people directly at this post - it's public, after all. And if you have any ideas for communities where I could ask questions like these, please let me know. The PHD Comic forums are down, and the old Papers (Mac research program) forum where you could ask anything has closed, so I'm pretty stuck for options. Thanks!

This post has been superceded by friends-only post here. If people who aren't on my trusted people list still want to comment, read this thread first.
baratron: (pikachu)
I am in the Science 2 Reading Room at the British Library. A man who is older than me is browsing Facebook on his laptop while searching for academic papers on a library computer. He just clicked on some drawings of Snorlax...

...I was SO tempted to lean over and growl "SNOR... LAX?" in his ear, but I thought it would be freaky :D
baratron: (goggles)
Today I'm trying to get on with my academic work, which is hard because I'm feeling somewhat phobic about the whole thing. The basic problem is that if you don't do any work on a certain topic for a couple of months, you forget everything you'd been doing. And if the reason you haven't done the work is because you've been too ill and brain-fried, the likelihood is that your notes from before you stopped are all over the place.

There is no way on Earth I'm going to meet the deadline of 30th September. My doctor has already agreed to write a letter to support me - I was just holding off on getting it until I knew when I was better. As with all episodes of depression, I'm a little afraid to state "I am better" because it seems like tempting fate, but I feel more able to cope. The problem now is that I'm terrified of how far behind I am. Not only am I supposed to get this first chapter of my thesis done by the end of this month, I'm supposed to have done enough of my research to have started lab synthesis by the end of the year. And it's just not going to happen.

This wouldn't be so bad if I didn't have to face that terrifying panel of people at the end of every year to have them confirm that I'm "allowed" to carry on with the PhD. I don't want to be kicked off the course because I was too ill to function. If they even suggest anything on those lines ("Oh, but it was only your first year, and you've had depression already - how are you going to manage the rest of your course?"), I am going to hit them with the Disability Discrimination Act so Fucking Hard. Tempted to prime the Disability Office now so they know it's a possibility. Hmm.

Right - I have 29 papers here to read, and I should make a start on that. Seeyas later.
baratron: (introspection)
For me, one of the main differences that distinguishes good from bad mental health is my ability to multitask. When I'm completely mentally healthy, I can multitask easily and if I'm trying to work and get blocked for some reason, I can switch to something else. When I'm not so mentally healthy, I get a single track mind and if I get blocked on whatever I'm supposed to be doing (e.g. because I can't get the papers I need), I can't get anything else done either. All my ability to focus is tied up with what I'm supposed to be doing and can't, and I don't know how to get it back so that I can concentrate on something else.

I think I've known this subconsciously for a very long time, but never actually articulated it before. Huh.

oh dear!

Jul. 21st, 2010 06:46 pm
baratron: (Default)
I've just discovered that both my supervisors will be away from 9th-20th August! If I wasn't so far behind with my work, this would of course be the perfect time for me to go away...

As it is, I'll just have to hope that no major showstopping problems turn up in that time :/
baratron: (rainbow chemistry geek)
Two HSP90 ligands I found today: NP4 and NP5.

What's wrong with them? Well, "normal" sizes for rings in organic chemistry are 3, 5, 6 and 7 carbon atoms. 3 carbons form a triangle, which is thermodynamically unstable because of the strain in the bonds (carbon atoms with all single bonds usually have bond angles around 109.5 degrees, and in a triangle they're closer to 60 degrees) - but common in nature, especially if stabilised by some other rings adjacent. 5, 6 and 7 carbon atoms are stable because there is no ring strain, and form very easily because it's a relatively small number of carbons to have to wrap around to form the ring. As the number of carbon atoms increases, the probability of ring formation decreases, because it's too far for the first and last carbons to "find" each other.

By the time you're up to a single ring of 13 carbon atoms, the molecule looks quite ludicrous. It looks to me like a normal molecule with two 6-membered rings, where someone's taken one of the rings and pumped it up with a cycle pump!

Profile

baratron: (Default)
baratron

March 2022

S M T W T F S
  12345
6789101112
1314151617 1819
20212223242526
2728293031  

Syndicate

RSS Atom

Most Popular Tags

Style Credit

Expand Cut Tags

No cut tags
Page generated May. 11th, 2026 12:47 am
Powered by Dreamwidth Studios